The DNA sequence of a gene can be altered in a number of ways. Gene variants (also known as mutations) can have varying effects on health, depending on where they occur and whether they alter the function of essential proteins. Variant types include the following: Show
Substitution This type of variant replaces one DNA building block (nucleotide) with another. Substitution variants can be further classified by the effect they have on the production of protein from the altered gene.
Insertion An insertion changes the DNA sequence by adding one or more nucleotides to the gene. As a result, the protein made from the gene may not function properly.Deletion A deletion changes the DNA sequence by removing at least one nucleotide in a gene. Small deletions remove one or a few nucleotides within a gene, while larger deletions can remove an entire gene or several neighboring genes. The deleted DNA may alter the function of the affected protein or proteins.Deletion-Insertion This variant occurs when a deletion and insertion happen at the same time in the same location in the gene. In a deletion-insertion variant, at least one nucleotide is removed and at least one nucleotide is inserted. However, the change must be complex enough to differ from a simple substitution. The resulting protein may not function properly. A deletion-insertion (delins) variant may also be known as an insertion-deletion (indel) variant. Duplication A duplication occurs when a stretch of one or more nucleotides in a gene is copied and repeated next to the original DNA sequence. This type of variant may alter the function of the protein made from the gene.Inversion An inversion changes more than one nucleotide in a gene by replacing the original sequence with the same sequence in reverse order. Frameshift A reading frame consists of groups of three nucleotides that each code for one amino acid . A frameshift variant occurs when there is an addition or loss of nucleotides that shifts the grouping and changes the code for all downstream amino acids. The resulting protein is usually nonfunctional. Insertions, deletions, and duplications can all be frameshift variants.Repeat expansion Some regions of DNA contain short sequences of nucleotides that are repeated a number of times in a row. For example, a trinucleotide repeat is made up of sequences of three nucleotides, and a tetranucleotide repeat is made up of sequences of four nucleotides. A repeat expansion is a variant that increases the number of times that the short DNA sequence is repeated. This type of variant can cause the resulting protein to function improperly.Frameshift mutation
What is a frameshift mutation? In biology, insertionsor deletions of nucleotides in the coding region resulting in an altered sequence of amino acids at the translation of the codons are known as frameshift mutations. This type of mutation may result in phenotypic changes, for instance, the production of an altered protein. What Causes a Frameshift Mutation?In a nucleic acid (e.g. DNA), the nucleotides may be “read” in groups of non-overlapping, consecutive triplets referred to altogether as a reading frame. During translation, triplets (or codons) in a reading frame are translated into specific amino acids (or a codon signal). Thus, if a mutation, for example, an insertion or a deletion of the nucleotide, occurs, this could result in the alteration of the reading frame. It completely changes the amino acid sequence. Such mutations are known as frameshift mutation (also called reading frame mutation, reading frame shift, or framing error). Figure 1. Frameshift mutation wherein deletion of CG alters the amino acid sequence. Source: Maria Victoria Gonzaga of Biology Online, modified diagram of Thomas Splettstoesser, CC BY-SA 4.0.Biology definition: You may be wondering, why are insertions and deletions called frameshift mutations? In the diagram above (Figure 1), notice how the insertion/deletion mutations (or indels) that are not in the multiples of three disrupted the reading frame and thus leads to a frameshift mutation. An incorrect amino acid has been formed by the deletion of two nucleotides, which in the above figure are the nucleotides with bases, cytosine (C) and guanine (G). Arginine (arg) has been replaced by glutamate (glu). (See Figure 2 for the amino acid code) The addition or deletion of the nucleotides in the multiples of three, however, will not alter the reading frame. Thus, the protein in such cases would likely have either an extra or missing amino acid. So, what occurs during frameshift mutation? Usually, frameshift mutations occur as caused by a mutational error during DNA repair or replication. They can also occur by exposure to acridine dyes, which are capable of inducing frameshift mutations. Due to insertion or deletion (also referred to as indels) of the nucleotide, the reading frame of the nucleotide sequence changes; however, the implication of these mutations depends on where they occur. The addition or deletion of a nucleotide can occur at the interstitial or intercalary position. In some instances, the addition and the deletion of nucleotides occur simultaneously (known as double frameshift), which eventually restore the reading frame to normal. The outcome of the frameshift mutation may be a complete loss of protein structure and functionality, resulting in the non-functional polypeptide. However, the effect of the mutation at the phenotypic level will be determined by the resulting codons, post-mutation, and the mutation position. The resultant codons after frameshift mutations can be of three types:
Hence, frameshift mutations result in an abnormal or defective protein product containing an improper sequence of amino acids. Depending upon the location of the mutation, such proteins may be wholly new or non-usable. Frameshift mutation can also result in the stop codon. This occurrence of the premature stop codon on mRNA will terminate the translation process, thereby, resulting in a short-length polypeptide. Depending on the extent and nature of frameshift mutation, the protein may either be shorter or longer in comparison to the normal protein. Such mutation can occur either spontaneously or due to environmental stimuli. An interesting fact is that frameshift mutations generally occur in the Adenine-Thymine (AT)-rich regions of the nucleic acid. Types of Frameshift MutationsFrameshift mutations can occur either by deleting or inserting the nucleotide in the nucleic acid (Figure 3). Deletion frameshift mutation, wherein one or more nucleotides are deleted in a nucleic acid, resulting in the alteration of the reading frame, i.e., reading frameshift, of the nucleic acid. Deletion is a more common mechanism for inducing the frameshift mutation that results in an altered reading frame. This mutation is also referred to as (+)1 frameshift mutation. Insertion frameshift mutation, wherein one or more nucleotides are added to the base sequence of the nucleic acid, which results in the change in the reading frame. The severity of this type of frameshift mutation is dependent on the number of nucleotides and the position of insertion of nucleotides. This mutation is also referred to as (-)1 frameshift mutation. Figure 3: Understanding frameshift mutation that may occur due to insertion or deletion of the nucleotide in the normal nucleotide sequence. Credit: US National Library of Medicine.Effects of Frameshift MutationsFrameshift mutations can result in:
The Genetic CodeAll the genetic information on the RNA and DNA is encoded in the nucleotides. This genetic code is present as a three nucleotides sequence. Each triplet of the nucleotide is eventually translated to form specific proteins required for various life processes. The conversion of this genetic code to protein occurs in two essential steps (Figure 4) 1. Transcription: herein, the genetic information written on the DNA “rewritten” on an RNA. Discovery of the Genetic CodeThe transmission of genetic traits in initial genetic experiments by Gregor Mendel indicated that genetic information is carried from one generation to another in some discrete physical and chemical entity. Later, amino acids were thought to be the carriers of genetic information. However, scientists such as Francis Crick, Sydney Brenner, Leslie Barnett, and Richard Watts-Tobin discovered the codons or the triplets on the DNA sequence. Marshall Nirenberg, Heinrich J. Matthaei, and Har Gobind Khorana (1961-1964) revealed the nature of a codon and deciphered the codons. Reading frames and triplet codonThe whole-genome sequence is divided into consecutive, non-overlapping sequences of three nucleotides. The triplet codon that initiates the translation process defines the reading frame. Each triplet of the nucleotide encodes a specific amino acid or a stop signal known as a codon. There are 64 codon combinations that encode 20 amino acids. However, out of these 64 codons, three are the stop codons; thus, 61 codons code for amino acids and three codons for the termination of the translation process (i.e., 61 codons amino acid + 3 stop codons= 64 codons). Some typical features of a codon are as follows:
Ribosome translocationEach codon is translated from an mRNA to an amino acid. These amino acids are then joined together by the ribosomes in a process known as ribosome translocation. Synthesis of protein is a cyclic process wherein, after joining one amino acid to the growing chain of the polypeptide, the ribosome moves forward by three bases (i.e. one codon) (Figure 6). The movement of ribosomes has disproportionate effects on protein or polypeptide function. Figure 6: Ribosomal translocation during protein elongation. Credit: Knight, J. R. P., et al. (2020).Frameshift Mutation ExamplesLet us understand frameshift mutation with an example of a base sequence in RNA that codes as below:AUG-AAT-AAC-GCU = start-leucine- asparagine-alanine In case mutation occurs in the above sequence and an A nucleotide is added or inserted after the start codon AUG. This will completely change the reading frame to: AUG-AAA-TAA-CGC = start-lysine- isoleucine- alanine Thus, we can see, the addition of only a single nucleotide in the RNA sequence completely altered the base sequence that resulted in the formation of completely different amino acids during the translation process. More Examples The reading frame of any mRNA is the coding sequence for a given polypeptide and is read continuously from the start codon AUG to one of the three stop codons. In translation, the ribosome moves down the mRNA three bases at a time and reads whatever codons follow the start codon. Adding or subtracting one or two bases (or any other number that is not a multiple of 3) can disrupt the normal reading frame and lead to the production of a completely nonfunctional protein. Frame shifts may also accidentally introduce an early stop codon. Original coding sequence: atggtgcatctgactcctgaggagaagtct Amino acid translation: M V H L T P E E K S Frameshift (remove underlined at): atggtgcctgactccTGAggagaagtct Amino acid translation: M V P D S * G E V X (* = termination at the TGA stop codon generated) Frameshift Mutation DiseasesMutations are a source of variation; however certain mutations can be deleterious and results in a disease condition. Some of the known diseases that are caused due to frameshift mutations are-
Effects of frameshift mutation:Frameshift mutations may be beneficial, deleterious, or lethal. For example, induction of frameshift mutation has been used to make certain bacteria capable of producing nylonase, an enzyme that can degrade nylon. Some cases of albinism have been attributed to the early termination of any of the enzymes necessary for the production of melanin. Tay Sachs disease is caused by various mutations, including frameshift mutations, in the HEXA gene, a gene on chromosome 15 that codes for the alpha-subunit of the lysosomal enzyme beta-N-acetylhexosaminidase A. Point Mutation vs. Frameshift MutationLet us compare and understand the difference between point mutation and frameshift mutation. In point mutation, one base is replaced by another base in the nucleotide sequence. Thus, the sequence of the nucleotide or the reading frame of the nucleic acid remains unchanged. Due to this reason, point mutation is also known as single base substitution. The point mutation can be – transition and transversion. DNA is made up of purines and pyrimidines. Transition point mutation occurs when a purine base is substituted into another purine base whereas transversion occurs when a pyrimidine or vice versa substitutes a purine base. In the case of frameshift mutation insertion or deletion of the base, it results in a modification in the reading frame of the nucleotide in a nucleic acid. Further differences between point mutation and frameshift mutation are enlisted in the table below.
Learn more about Mutations:
Based on the above details, let us attempt to answer a few questions by answering the quiz
below. References
©BiologyOnline.com. Content provided and moderated by Biology Online Editors. Why does frameshift mutation always result in a nonfunctional protein?A reading frame consists of groups of three nucleotides that each code for one amino acid . A frameshift variant occurs when there is an addition or loss of nucleotides that shifts the grouping and changes the code for all downstream amino acids. The resulting protein is usually nonfunctional.
Why is a frameshift mutation far more likely to lead to a defective protein than a point mutation?Because an insertion or deletion results in a frame-shift that changes the reading of subsequent codons and, therefore, alters the entire amino acid sequence that follows the mutation, insertions and deletions are usually more harmful than a substitution in which only a single amino acid is altered.
What type of mutation is more likely to result in nonfunctional protein?A frameshift mutation is a mutation that is more expected to result in a nonfunctional protein than a point mutation.
Why is a frameshift mutation the most harmful?Frameshift mutations are among the most deleterious changes to the coding sequence of a protein. They are extremely likely to lead to large-scale changes to polypeptide length and chemical composition, resulting in a non-functional protein that often disrupts the biochemical processes of a cell.
|